Publication catalog

Biomedical publications with connected research

Browse 1,060,000 source-attributed publications. Article pages show available bibliographic context, indexed concepts and SPECTER2 related publications where supported by the source and graph. Missing metadata is not invented, and source retraction notices remain visible.

Semantic proximity supports literature exploration. It does not establish scientific or clinical evidence.

Publications

Page 7383 of 10600

Whole-genome analysis reveals unexpected dynamics of mutant subclone development in a patient with JAK2-V617F-positive chronic myeloid leukemia.
Experimental hematology | 2017-09-01 | PMID 28602946
Sloma Ivan, Mitjavila-Garcia Maria Teresa, Feraud Olivier and 15 more
Genes: ABL1, BCR, ASXL1, JAK2
A versatile genetic tool to study midline glia function in the Drosophila CNS.
Developmental biology | 2017-09-01 | PMID 28602954
Banerjee Swati, Mino Rosa E, Fisher Elizabeth S and 1 more
FZD8, a target of p53, promotes bone metastasis in prostate cancer by activating canonical Wnt/β-catenin signaling.
Cancer letters | 2017-08-28 | PMID 28602974
Li Qiji, Ye Liping, Zhang Xin and 9 more
Genes: FZD8
Suppression of Akt1-β-catenin pathway in advanced prostate cancer promotes TGFβ1-mediated epithelial to mesenchymal transition and metastasis.
Cancer letters | 2017-08-28 | PMID 28602980
Gao Fei, Alwhaibi Abdulrahman, Sabbineni Harika and 3 more
Detection of uncommon G3P[3] rotavirus A (RVA) strain in rat possessing a human RVA-like VP6 and a novel NSP2 genotype.
Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases | 2017-09-01 | PMID 28603021
Ianiro Giovanni, Di Bartolo Ilaria, De Sabato Luca and 3 more
Variation analysis of norovirus among children with diarrhea in rural Hebei Province, north of China.
Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases | 2017-09-01 | PMID 28603022
Qiao Niu, Wang Song-Mei, Wang Jin-Xia and 9 more
FTO gene polymorphisms (rs9939609 and rs17817449) as predictors of Type 2 Diabetes Mellitus in obese Iraqi population.
Gene | 2017-09-05 | PMID 28603074
Younus Laith A, Algenabi Abdul Hussein A, Abdul-Zhara Mohammed S and 1 more
Genes: FTO
Circulating autoantibodies to endogenous erythropoietin are associated with chronic hepatitis C virus infection-related anemia.
Hepatobiliary & pancreatic diseases international : HBPD INT | 2017-06-01 | PMID 28603097
Tsiakalos Aristotelis, Voumvas Theoharis, Psarris Alexandros and 5 more
Genes: EPO
Report: Impact of drug combination of clopidogrel and pantoprazole In the prognosis of patients with transient ischemic attack.
Pakistan journal of pharmaceutical sciences | 2017-01-01 | PMID 28603135
Lu Min
Genes: ABCD2
A 6-year-old girl diagnosed with mevalonate kinase deficiency who had hydrops fetalis and neonatal-onset cholestasis.
Nihon Rinsho Men'eki Gakkai kaishi = Japanese journal of clinical immunology | 2017-01-01 | PMID 28603204
Yamashita Yuriko, Matsumoto Shinsuke, Hiramoto Ryugo and 6 more
Unique Trichomonas vaginalis gene sequences identified in multinational regions of Northwest China.
Bioscience trends | 2017-07-24 | PMID 28603223
Liu Jun, Feng Meng, Wang Xiaolan and 3 more
Molecular epidemiology and antibiotic resistance patterns of Enterococcus faecalis isolates from hospitals in Tehran.
Le infezioni in medicina | 2017-06-01 | PMID 28603229
Saeidi Somayyeh, Mirnejad Reza, Masoumi Zavaryani Sara and 1 more
High frequency of hopQ genotypes among Iranian Helicobacter pylori clinical isolates.
Le infezioni in medicina | 2017-06-01 | PMID 28603230
Dara Mahintaj, Khashei Reza, Dehghani Behzad
Association between butyrylcholinesterase K variant and mild cognitive impairment in the Thai community-dwelling patients.
Clinical interventions in aging | 2017-01-01 | PMID 28603409
Pongthanaracht Natsalil, Yanarojana Somchai, Pinthong Darawan and 4 more
Distinct DNA methylation profiles in subtypes of orofacial cleft.
Clinical epigenetics | 2017-01-01 | PMID 28603561
Sharp Gemma C, Ho Karen, Davies Amy and 7 more
Genes: CPO, HOXA2, PDGFRA, TBX1
Dispersal and Transmission of Avian Paramyxovirus Serotype 4 among Wild Birds and Domestic Poultry.
Frontiers in cellular and infection microbiology | 2017-01-01 | PMID 28603697
Yin Renfu, Zhang Pingze, Liu Xinxin and 17 more
Pretransplant 4β-hydroxycholesterol does not predict tacrolimus exposure or dose requirements during the first days after kidney transplantation.
British journal of clinical pharmacology | 2017-11-01 | PMID 28603840
Vanhove Thomas, Hasan Mahmoud, Annaert Pieter and 2 more
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
International journal of laboratory hematology | 2017-10-01 | PMID 28603845
Rizo-de-la-Torre L C, Ibarra B, Sánchez-López J Y and 3 more
Genes: HBB
Identification of PTPN22, ST6GAL1 and JAZF1 as psoriasis risk genes demonstrates shared pathogenesis between psoriasis and diabetes.
Experimental dermatology | 2017-11-01 | PMID 28603863
Wang Honglei, Wang Zhenzhen, Rani Parimi Leela and 18 more
Genes: JAZF1, PTPN22
Mutation in IL36RN impairs the processing and regulatory function of the interleukin-36-receptor antagonist and is associated with DITRA syndrome.
Experimental dermatology | 2019-10-01 | PMID 28603914
Bal Elodie, Lim Ai Ching, Shen Min and 10 more
A rare castration-resistant progenitor cell population is highly enriched in Pten-null prostate tumours.
The Journal of pathology | 2017-09-01 | PMID 28603917
Sackmann Sala Lucila, Boutillon Florence, Menara Giulia and 14 more
Genes: PRL
CFTR-France, a national relational patient database for sharing genetic and phenotypic data associated with rare CFTR variants.
Human mutation | 2017-10-01 | PMID 28603918
Claustres Mireille, Thèze Corinne, des Georges Marie and 22 more
Genes: CFTR
Analysis of Lysophospholipid Content in Low Phytate Rice Mutants.
Journal of agricultural and food chemistry | 2017-07-05 | PMID 28603982
Tong Chuan, Chen Yaling, Tan Yuanyuan and 5 more
Genes: LPL
Simultaneous identification of Haemophilus influenzae and Haemophilus haemolyticus using real-time PCR.
Future microbiology | 2017-06-01 | PMID 28604066
Price Erin P, Harris Tegan M, Spargo Jessie and 5 more
Novel human metapneumovirus with a 180-nucleotide duplication in the G gene.
Future microbiology | 2017-06-01 | PMID 28604069
Piñana María, Vila Jorgina, Gimferrer Laura and 11 more
Adaptation to copper stress influences biofilm formation in Alteromonas macleodii.
Biofouling | 2017-07-01 | PMID 28604167
Cusick Kathleen D, Dale Jason R, Fitzgerald Lisa A and 2 more
Genetic factors related with early onset of osteonecrosis of the jaw in patients with multiple myeloma under zoledronic acid therapy.
Leukemia & lymphoma | 2017-10-01 | PMID 28604257
Kastritis Efstathios, Melea Pelagia, Bagratuni Tina and 7 more
Genes: PPARG
Clinician Perspectives of Antisocial and Borderline Personality Disorders Using DSM-5 Section III Dimensional Personality Traits.
Journal of personality disorders | 2018-04-01 | PMID 28604276
Anderson Jaime L, Sellbom Martin, Shealy R Clayton
Dietary Iron and Heme Iron Consumption, Genetic Susceptibility, and Risk of Crohn's Disease and Ulcerative Colitis.
Inflammatory bowel diseases | 2017-07-01 | PMID 28604414
Khalili Hamed, de Silva Punyanganie S, Ananthakrishnan Ashwin N and 6 more
No shortcuts: new findings reinforce why nuance is the rule in genetic autoinflammatory syndromes.
Current opinion in rheumatology | 2017-09-01 | PMID 28604422
Tsoukas Paul, Canna Scott W
Impact of CYP2C19 Genotype and Liver Function on Voriconazole Pharmacokinetics in Renal Transplant Recipients.
Therapeutic drug monitoring | 2017-08-01 | PMID 28604474
Li Zi-Wei, Peng Feng-Hua, Yan Miao and 11 more
A Replication Study for Association of LBX1 Locus With Adolescent Idiopathic Scoliosis in French-Canadian Population.
Spine | 2018-02-01 | PMID 28604496
Nada Dina, Julien Cédric, Samuels Mark E and 1 more
Genes: LBX1
Classification of Cowpox Viruses into Several Distinct Clades and Identification of a Novel Lineage.
Viruses | 2017-06-10 | PMID 28604604
Franke Annika, Pfaff Florian, Jenckel Maria and 6 more
AA-NAT, MT1 and MT2 Correlates with Cancer Stem-Like Cell Markers in Colorectal Cancer: Study of the Influence of Stage and p53 Status of Tumors.
International journal of molecular sciences | 2017-06-11 | PMID 28604612
Casado Jorge, Iñigo-Chaves Almudena, Jiménez-Ruiz Sergio M and 7 more
Association of miR-938G>A Polymorphisms with Primary Ovarian Insufficiency (POI)-Related Gene Expression.
International journal of molecular sciences | 2017-06-12 | PMID 28604625
Cho Sung Hwan, Ahn Eun Hee, An Hui Jeong and 5 more
Cholesterol and fatty acids regulate cysteine ubiquitylation of ACAT2 through competitive oxidation.
Nature cell biology | 2017-07-01 | PMID 28604676
Wang Yong-Jian, Bian Yan, Luo Jie and 10 more
Genes: ACAT2
Pramel7 mediates ground-state pluripotency through proteasomal-epigenetic combined pathways.
Nature cell biology | 2017-07-01 | PMID 28604677
Graf Urs, Casanova Elisa A, Wyck Sarah and 16 more
Genes: UHRF1, PRAME
A mutant O-GlcNAcase enriches Drosophila developmental regulators.
Nature chemical biology | 2017-08-01 | PMID 28604694
Selvan Nithya, Williamson Ritchie, Mariappa Daniel and 7 more
Genes: OGT, OGA
Identification of 19 new risk loci and potential regulatory mechanisms influencing susceptibility to testicular germ cell tumor.
Nature genetics | 2017-07-01 | PMID 28604728
Litchfield Kevin, Levy Max, Orlando Giulia and 28 more
Genes: KIT
Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes.
Nature genetics | 2017-07-01 | PMID 28604730
McKay James D, Hung Rayjean J, Han Younghun and 137 more
Genes: CHRNA2, NRG1, RNASET2, RTEL1
Genome-wide association analysis of insomnia complaints identifies risk genes and genetic overlap with psychiatric and metabolic traits.
Nature genetics | 2017-11-01 | PMID 28604731
Hammerschlag Anke R, Stringer Sven, de Leeuw Christiaan A and 19 more
Genes: MEIS1
Meta-analysis of five genome-wide association studies identifies multiple new loci associated with testicular germ cell tumor.
Nature genetics | 2017-07-01 | PMID 28604732
Wang Zhaoming, McGlynn Katherine A, Rajpert-De Meyts Ewa and 20 more
Melanocytic nevi and melanoma: unraveling a complex relationship.
Oncogene | 2017-10-19 | PMID 28604751
Damsky W E, Bosenberg M
Pervasive antagonistic interactions among hybrid incompatibility loci.
PLoS genetics | 2017-06-01 | PMID 28604770
Guerrero Rafael F, Muir Christopher D, Josway Sarah and 1 more
p63 exerts spatio-temporal control of palatal epithelial cell fate to prevent cleft palate.
PLoS genetics | 2017-06-01 | PMID 28604778
Richardson Rose, Mitchell Karen, Hammond Nigel L and 15 more
Viral genetic variation accounts for a third of variability in HIV-1 set-point viral load in Europe.
PLoS biology | 2017-06-01 | PMID 28604782
Blanquart François, Wymant Chris, Cornelissen Marion and 27 more
Genome-wide association analysis and functional annotation of positional candidate genes for feed conversion efficiency and growth rate in pigs.
PloS one | 2017-01-01 | PMID 28604785
Horodyska Justyna, Hamill Ruth M, Varley Patrick F and 2 more
Genes: MBD5, PRKDC, SELL
Temporal fitness fluctuations in experimental Arabidopsis thaliana populations.
PloS one | 2017-01-01 | PMID 28604796
Hu Jinyong, Lei Li, de Meaux Juliette
A Bayesian mathematical model of motor and cognitive outcomes in Parkinson's disease.
PloS one | 2017-01-01 | PMID 28604798
Hayete Boris, Wuest Diane, Laramie Jason and 12 more
Genes: BST1
Characterising variation in wheat traits under hostile soil conditions in India.
PloS one | 2017-01-01 | PMID 28604800
Khokhar Jaswant S, Sareen Sindhu, Tyagi Bhudeva S and 7 more
Genotype diversity and molecular evolution of noroviruses: A 30-year (1982-2011) comprehensive study with children from Northern Brazil.
PloS one | 2017-01-01 | PMID 28604828
Siqueira Jones Anderson Monteiro, Bandeira Renato da Silva, Oliveira Darleise de Souza and 2 more
[Application of SNP-array technology in the genetic analysis of pediatric patients with growth retardation].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics | 2017-06-10 | PMID 28604947
Luo Shiyu, Fu Chunyun, Zhang Shujie and 10 more
[Characteristics of phenylalanine hydroxylase gene mutations among patients with phenylketonuria from Linyi region of Shandong Province].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics | 2017-06-10 | PMID 28604955
Li Huafeng, Li Yongli, Zhang Li
Genes: PAH
[Analysis of PKD1 gene mutation in a family affected with autosomal dominant polycystic kidney disease].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics | 2017-06-10 | PMID 28604956
Mei Jin, Wang Min, Wang Hao and 2 more
Genes: PKD1
[Molecular genetic study of a family affected with punctate palmoplantar keratoderma].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics | 2017-06-10 | PMID 28604957
Jia Yueqin, Wang Shaowei, Zhu Yingyu and 1 more
Genes: CELA1
[Study of a family affected with focal segmental glomerulosclerosis due to mutation of COL4A5 gene].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics | 2017-06-10 | PMID 28604958
Zhang Jing, Yang Jing, Hu Zhangxue
[Analysis of TCIRG1 gene mutation in a Chinese family affected with infantile malignant osteopetrosis].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics | 2017-06-10 | PMID 28604959
Wang Min, Chen Tianping, Jin Ling and 7 more
Genes: TCIRG1
[Analysis of UQCRB gene mutation in a child with mitochondrial complex III deficiency].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics | 2017-06-10 | PMID 28604960
Zhang Ting, Hong Fang, Qian Guling and 5 more
Genes: UQCRB
[Analysis of SLC39A4 gene mutation in a patient with acrodermatitis enteropathica].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics | 2017-06-10 | PMID 28604961
Mu Yunzhu, Zhang Zhengzhong, Yang Ping and 4 more
[Phenotypic and genotypic analysis of a fetus carrying an intermediate 22q11.2 deletion encompassing the CRKL gene].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics | 2017-06-10 | PMID 28604963
Lin Shaobin, Zheng Xiaohe, Gu Heng and 1 more
Genes: CRKL, COMT, HIRA, MAPK1, TBX1
[Phenotypic and genetic analysis of a boy with partial trisomy of 1q].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics | 2017-06-10 | PMID 28604964
Wu Dong, Zhang Hui, Wang Hongdan and 5 more
[Study of the molecular basis for an individual with Bel variant due to deletion of B glycosyltransferase gene].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics | 2017-06-10 | PMID 28604970
Ying Yanling, Hong Xiaozhen, Chen Shu and 5 more
Genes: ABO
[A case of Bw39 subtype caused by 562C to T mutation of exon 7 of α -1,3-D-galactosyltransferase gene].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics | 2017-06-10 | PMID 28604971
Wang Bijin, Shi Lili, Wang Lin and 3 more
Genes: ABO
[Molecular mechanism for a case with ABO subtype Bx10/O01].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics | 2017-06-10 | PMID 28604972
Yang Liang, Du Yong, Mei Chuanliang and 1 more
Genes: ABO
[Serological and molecular analysis of a case with para-Bombay phenotype caused by a h328(nt328G to A) mutation].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics | 2017-06-10 | PMID 28604973
Geng Wei, Gao Huanhuan, Liu Peiyan and 1 more
Genes: FUT1, ABO, FUT2
[Study on the CFHR1 level and its genetic polymorphisms in type 2 diabetes mellitus patients].
Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics | 2017-06-10 | PMID 28604974
Wang Jun, Yu Wei, Xu Jiazhang and 2 more
Genes: CFHR1, CFH
Association of N-acetyltransferase 1 polymorphism and bladder cancer risk: an updated meta-analysis and trial sequential analysis.
The International journal of biological markers | 2017-07-24 | PMID 28604993
Xu Zicheng, Li Xiao, Qin Zhiqiang and 7 more
Genes: NAT1
Phenotyping of gut microbiota: Focus on capillary electrophoresis.
Electrophoresis | 2017-09-01 | PMID 28605027
Ferrer Manuel, Raczkowska Beata Anna, Martínez-Martínez Mónica and 2 more
Typical angina is associated with greater coronary endothelial dysfunction but not abnormal vasodilatory reserve.
Clinical cardiology | 2017-10-01 | PMID 28605043
AlBadri Ahmed, Leong Derek, Bairey Merz C Noel and 10 more
Genes: CAD
Prevalence of CYP3A5 Genomic Variances and Their Impact on Tacrolimus Dosing Requirements among Kidney Transplant Recipients in Eastern North Carolina.
Pharmacotherapy | 2017-09-01 | PMID 28605053
Maldonado Angela Q, Asempa Tomefa, Hudson Suzanne and 1 more
The Bacillus subtilis germinant receptor GerA triggers premature germination in response to morphological defects during sporulation.
Molecular microbiology | 2017-09-01 | PMID 28605069
Ramírez-Guadiana Fernando H, Meeske Alexander J, Wang Xindan and 2 more
Array-based molecular karyotyping in 115 VATER/VACTERL and VATER/VACTERL-like patients identifies disease-causing copy number variations.
Birth defects research | 2017-07-17 | PMID 28605140
Zhang Rong, Marsch Florian, Kause Franziska and 26 more
Musculoskeletal Disease in MDA5-Related Type I Interferonopathy: A Mendelian Mimic of Jaccoud's Arthropathy.
Arthritis & rheumatology (Hoboken, N.J.) | 2017-10-01 | PMID 28605144
de Carvalho Luciana Martins, Ngoumou Gonza, Park Ji Woo and 17 more
Genes: IFIH1
Increase in multiple paternity across the reproductive lifespan in a sperm-storing, hermaphroditic freshwater snail.
Molecular ecology | 2017-10-01 | PMID 28605149
Bürkli Anja, Jokela Jukka
Early Response-Based Therapy Stratification Improves Survival in Adult Early Thymic Precursor Acute Lymphoblastic Leukemia: A Group for Research on Adult Acute Lymphoblastic Leukemia Study.
Journal of clinical oncology : official journal of the American Society of Clinical Oncology | 2017-08-10 | PMID 28605290
Bond Jonathan, Graux Carlos, Lhermitte Ludovic and 17 more
Power and sample size calculations for high-throughput sequencing-based experiments.
Briefings in bioinformatics | 2018-11-27 | PMID 28605403
Li Chung-I, Samuels David C, Zhao Ying-Yong and 2 more
CloudNeo: a cloud pipeline for identifying patient-specific tumor neoantigens.
Bioinformatics (Oxford, England) | 2017-10-01 | PMID 28605406
Bais Preeti, Namburi Sandeep, Gatti Daniel M and 2 more
Antibiotic susceptibility in vitro of Francisella tularensis subsp. holarctica isolates from Germany.
The Journal of antimicrobial chemotherapy | 2017-09-01 | PMID 28605439
Tomaso Herbert, Hotzel Helmut, Otto Peter and 2 more
Prioritizing tests of epistasis through hierarchical representation of genomic redundancies.
Nucleic acids research | 2017-08-21 | PMID 28605458
Cowman Tyler, Koyutürk Mehmet
Strand-specific CpG hemimethylation, a novel epigenetic modification functional for genomic imprinting.
Nucleic acids research | 2017-09-06 | PMID 28605464
Patiño-Parrado Iris, Gómez-Jiménez Álvaro, López-Sánchez Noelia and 1 more
In vitro activity of the novel antifungal compound F901318 against difficult-to-treat Aspergillus isolates.
The Journal of antimicrobial chemotherapy | 2017-09-01 | PMID 28605488
Buil J B, Rijs A J M M, Meis J F and 4 more
Impact of Young Age on the Presentation of Saccular Intracranial Aneurysms: Population-Based Analysis of 4082 Patients.
Neurosurgery | 2018-06-01 | PMID 28605505
Räisänen Sari, Frösen Juhana, Kurki Mitja I and 7 more
A novel homozygous UMOD mutation reveals gene dosage effects on uromodulin processing and urinary excretion.
Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant Association - European Renal Association | 2017-12-01 | PMID 28605509
Edwards Noel, Olinger Eric, Adam Jennifer and 6 more
Genes: UMOD, EGF
Low-coverage resequencing detects meiotic recombination pattern and features in tomato RILs.
DNA research : an international journal for rapid publication of reports on genes and genomes | 2017-12-01 | PMID 28605512
de Haas Lars S, Koopmans Roy, Lelivelt Cilia L C and 3 more
Functional Analysis Reveals Geographical Variation in Inhibitory Immune Responses Against a Polymorphic Malaria Antigen.
The Journal of infectious diseases | 2017-07-15 | PMID 28605544
Bei Amy K, Ahouidi Ambroise D, Dvorin Jeffrey D and 8 more
Atypical Forms of Congenital Hyperinsulinism in Infancy Are Associated With Mosaic Patterns of Immature Islet Cells.
The Journal of clinical endocrinology and metabolism | 2017-09-01 | PMID 28605545
Han Bing, Mohamed Zainab, Estebanez Maria Salomon and 11 more
Pyruvate Kinase and Fcγ Receptor Gene Copy Numbers Associated With Malaria Phenotypes.
The Journal of infectious diseases | 2017-07-15 | PMID 28605553
Faik Imad, van Tong Hoang, Lell Bertrand and 3 more
Genes: PKLR
Deriving, regenerating, and engineering CNS tissues using human pluripotent stem cells.
Current opinion in biotechnology | 2017-10-01 | PMID 28605638
Lemke Kristen A, Aghayee Alireza, Ashton Randolph S
Fast STR allele identification with STRait Razor 3.0.
Forensic science international. Genetics | 2017-09-01 | PMID 28605651
Woerner August E, King Jonathan L, Budowle Bruce
Association of endothelial nitric oxide synthase gene variants (-786 T>C, intron 4 b/a VNTR and 894 G>T) with idiopathic recurrent pregnancy loss: A case-control study with haplotype and in silico analysis.
European journal of obstetrics, gynecology, and reproductive biology | 2017-08-01 | PMID 28605668
Azani Alireza, Hosseinzadeh Asghar, Azadkhah Roya and 9 more
Diversity, classification and evolution of CRISPR-Cas systems.
Current opinion in microbiology | 2017-06-01 | PMID 28605718
Koonin Eugene V, Makarova Kira S, Zhang Feng
A Clinical Case of Catecholaminergic Polymorphic Ventricular Tachycardia: The Clinical Suspicious and the Need of Genetics.
Cardiology | 2000-01-01 | PMID 28605744
Del Franco Annamaria, Gualandi Francesca, Malagù Michele and 4 more
PLS3 Mutations in X-Linked Osteoporosis: Clinical and Bone Characteristics of Two Novel Mutations.
Hormone research in paediatrics | 2017-01-01 | PMID 28605746
Kannu Peter, Mahjoub Areej, Babul-Hirji Riyana and 2 more
Genes: PLS3
Characterization of the Phenotype Associated with Microduplication Reciprocal to NF1 Microdeletion Syndrome.
Cytogenetic and genome research | 2017-01-01 | PMID 28605748
Tassano Elisa, Giacomini Thea, Severino Mariasavina and 4 more
Surveying the Maize community for their diversity and pedigree visualization needs to prioritize tool development and curation.
Database : the journal of biological databases and curation | 2017-01-01 | PMID 28605768
Sen Taner Z, Braun Bremen L, Schott David A and 6 more
The first report of prion-related protein gene (PRNT) polymorphisms in goat.
Acta veterinaria Hungarica | 2017-06-01 | PMID 28605958
Kim Yong-Chan, Jeong Byung-Hoon
Genes: PRND, PRNP, SPRN
In vitro sensitivity to antimalarial drugs and polymorphisms in Pfg377 gene in Plasmodium falciparum field isolates from Mewat, India.
Pathogens and global health | 2017-07-01 | PMID 28605993
Singh Vineeta, Kumar Amit, Gupta Purva
Potential Minor Haplotypes of CYP2D6 in the Japanese Population.
Drug metabolism letters | 2017-11-17 | PMID 28606035
Masuda Masatoshi, Fujiwara Tsutomu, Matsunaga Masayuki and 1 more
Comparative genome and transcriptome analysis reveals distinctive surface characteristics and unique physiological potentials of Pseudomonas aeruginosa ATCC 27853.
BMC genomics | 2017-06-12 | PMID 28606056
Cao Huiluo, Lai Yong, Bougouffa Salim and 2 more
What is the impact of PCSK9 rs505151 and rs11591147 polymorphisms on serum lipids level and cardiovascular risk: a meta-analysis.
Lipids in health and disease | 2017-06-12 | PMID 28606094
Qiu Chengfeng, Zeng Pingyu, Li Xiaohui and 7 more
Genes: PCSK9