Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

Abstract excerpt

INTRODUCTION: Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. METHODS: One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A...

Topics

Share this publication in a Topic to start or enrich a Post.

• Share to beta-Globins
• Share to beta-Thalassemia