Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

doi:10.1111/ijlh.12692

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Back to search

Article

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

International journal of laboratory hematology - 1 Oct 2017

Rizo-de-la-Torre L C, Ibarra B, Sánchez-López J Y, Magaña-Torres M T, Rentería-López V M, Perea-Díaz F J

Abstract excerpt

INTRODUCTION: Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. METHODS: One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A...

Topics

Adolescent
Adult
Aged
Alleles
Child
Child, Preschool
Codon
DNA Mutational Analysis
Exons
Female
Genetic Heterogeneity

Methodology Data sources Editorial policy Privacy About Contact Helena Bioinformatics

Genotype

Humans

Infant

Introns

Male

Mexico

Middle Aged

Source

Open in PubMed

Identifiers

PMID: 28603845
DOI: 10.1111/ijlh.12692

Genes

Variants

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 30 Aug 2026.

Community interpretation

Discuss the evidence

Ask a question, add context or challenge an interpretation. Community activity is separate from scientific evidence strength.

discussions

replies

Citations encouraged

Claims remain attributable.

No discussion yet

Be the first to add a careful, cited interpretation.

Related research

Semantic proximity does not establish scientific evidence.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.PMID 28603845Read ↗

Three Mexican Families with β thalassemia intermedia with different molecular basisSemantic proximity Read ↗

Molecular and Hematological Analysis of Alpha- and Beta-Thalassemia in a Cohort of Mexican Patients.Semantic proximity Read ↗

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).Semantic proximity Read ↗

Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil.Semantic proximity Read ↗

Molecular Basis of β-Thalassemia in the Population of the Aegean Region of Turkey: Identification of A Novel Deletion Mutation.Semantic proximity Read ↗

The Spectrum of β-Thalassemia Mutations in the Population Migration in Lebanon: A 6-Year Retrospective Study.Semantic proximity Read ↗

IVS-II-648/649 (-T) (HBB: c.316-202del) Triggers a Novel β-Thalassemia Phenotype.Semantic proximity Read ↗

Beta-Thalassemia in Spain: Results From the National Thalassemia Registry and Molecular Analysis of Patients With Transfusion-Dependent Thalassemia.Semantic proximity Read ↗

Identification of three novel mutations [-41 (A>C), codon 24 (-G), and IVS-I-109 (-T)], in a study of beta-thalassemia alleles in the Isfahan region of Iran.Semantic proximity Read ↗

Spectrum of beta-thalassemia in Jordan: identification of two novel mutations.Semantic proximity Read ↗

Molecular updating of β-thalassemia mutations in the Upper Egyptian population.Semantic proximity Read ↗

Molecular Characterization and Hematological Aspects of Hb E-Myanmar [β26(B8)Glu→Lys and β65(E9)Lys→Asn, HBB: c.[79G>A;198G>C]): A Novel β-Thalassemic Hemoglobin Variant.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.