Back to search

Article

Allelic spectrum of the RNA guided CRISPR/Cas9 DNA repair events at PAM associated trinucleotide repeat (NGG)n in <i>Caenorhabditis elegans.</i>

2016-07-10

Abstract excerpt

This work describes the experience with implementation of Streptococcus pyogenes Cas9 nuclease, expressed in C. elegans germline. The described work utilizes guide RNA-unc-22-1000 (GGAGAAGGAGGCGGTGCTGG) designed to target the polyglycine encoding stretch within the unc-22 gene embedding the impure trinucleotide (NGG)n PAM repeat region. We describe the allelic spectrum of mutational events identified at positio...

Topics

Open a Topic to create a Post that cites this publication.

Identifiers and source

Literature Corpus work
02246168-3110-5aff-a981-a2d3cfaba47d
DOI
10.1101/062489
Open publication

Related research

Semantic proximity does not establish scientific evidence.

Click a neighbor to travelStep 1 · 12 closest
Interactive article relationship graphSelect a related publication card to move it into the centre and load its closest explainable connections. Solid lines are source-backed structured connections. Dashed lines are semantic discovery signals and are not scientific evidence.
Allelic spectrum of the RNA guided CRISPR/Cas9 DNA repair events at PAM associated trinucleotide repeat (NGG)n in <i>Caenorhabditis elegans.</i>DOI 10.1101/062489
Differential efficacies of Cas nucleases on microsatellites involved in human disorders and associated off-target mutationsSemantic proximity
Resection and repair of a Cas9 double-strand break at CTG trinucleotide repeats induces local and extensive chromosomal rearrangementsSemantic proximity
Cas9 Variants Expand the Target Repertoire in Caenorhabditis elegans.Semantic proximity
Differential efficacies of Cas nucleases on microsatellites involved in human disorders and associated off-target mutations.Semantic proximity
Disruption of dog-1 in Caenorhabditis elegans triggers deletions upstream of guanine-rich DNA.Semantic proximity
Rapid and precise engineering of the Caenorhabditis elegans genome with lethal mutation co-conversion and inactivation of NHEJ repair.Semantic proximity
Highly specific contractions of a single CAG/CTG trinucleotide repeat by TALEN in yeast.Semantic proximity
Single Nucleotide Substitutions Effectively Block Cas9 and Allow for Scarless Genome Editing in <i>Caenorhabditis elegans</i>Semantic proximity
CRISPR/Cas9-induced double-strand breaks in huntingtin locus lead to CAG repeat contraction through the extensive DNA end resection and homology-mediated repairSemantic proximity
De Novo identification of single nucleotide mutations in Caenorhabditis elegans using array comparative genomic hybridization.Semantic proximity
Analyses of point mutation repair and allelic heterogeneity generated by CRISPR/Cas9 and single-stranded DNA oligonucleotides.Semantic proximity
Induction and repair of zinc-finger nuclease-targeted double-strand breaks in Caenorhabditis elegans somatic cells.Semantic proximity
Select a neighboring publication to make it the new centre.