Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

Quadruplex DNA formation in a region of the tRNA gene supF associated with hydrogen peroxide mediated mutations.

Biochemistry - 3 Sept 1991

Akman S A, Lingeman R G, Doroshow J H, Smith S S

Abstract excerpt

A hot spot for H2O2/Fe-mediated mutation has been observed between bases 154 and 170 of the supF gene in the mutation reporter plasmid pZ189 [Moraes et al. (1990) Carcinogenesis 11, 283; Akman et al. (1991) Mutat. Res. (in press)]. To further characterize this hot spot, we synthesized the 33mer d(pAAAGTGATGGTGGTGGGGGAAGGATTCGAACCT) (pZ33), which is complementary to bases 159-191 of the supF gene. pZ33 annealed...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to Base Sequence
Share to DNA, Bacterial
Share to Electrophoresis, Polyacrylamide Gel

Methodology Data sources Editorial policy Privacy Delete account & data About Contact Helena Bioinformatics

Share to Escherichia coli

Share to Genes, Bacterial

Share to Molecular Sequence Data

Share to Mutation

Share to Plasmids

Source

Identifiers

PMID: 1888727
DOI: 10.1021/bi00099a022

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 7 Sept 2026. Manifest publication-graph-cohort-2026-09-08.1.

Source receipt: pubmed, retrieved 7 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence. Graph snapshot: 2026-09-29.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

Quadruplex DNA formation in a region of the tRNA gene supF associated with hydrogen peroxide mediated mutations.PMID 1888727Read ↗

Copper-dependent site-specific mutagenesis by benzoyl peroxide in the supF gene of the mutation reporter plasmid pS189.Semantic proximity Read ↗

Mutagenesis by hydrogen peroxide treatment of mammalian cells: a molecular analysis.Semantic proximity Read ↗

Mutations induced in the supF gene of pSP189 by hydroxyl radical and singlet oxygen: relevance to peroxynitrite mutagenesis.Semantic proximity Read ↗

Mutations induced by ionizing radiation in a plasmid replicated in human cells. I. Similar, nonrandom distribution of mutations in unirradiated and X-irradiated DNA.Semantic proximity Read ↗

Effects of peroxynitrite dose and dose rate on DNA damage and mutation in the supF shuttle vector.Semantic proximity Read ↗

Mutagenic activity of ambient oxygen and mitomycin C in Fanconi's anaemia cells.Semantic proximity Read ↗

Mutations induced in a shuttle vector plasmid exposed to monofunctionally activated mitomycin C.Semantic proximity Read ↗

Mutations at G:C base pairs predominate after replication of peroxyl radical-damaged pSP189 plasmids in human cells.Semantic proximity Read ↗

ELF electromagnetic fields increase hydrogen peroxide (H2O2)-induced mutations in pTN89 plasmids.Semantic proximity Read ↗

N-methyl-N-nitrosourea-induced mutations in a shuttle plasmid replicated in human cells.Semantic proximity Read ↗

Carbon dioxide modulation of peroxynitrite-induced mutagenesis of the supF gene in pSP189.Semantic proximity Read ↗

Damage distribution and mutation spectrum: the case of 8-methoxypsoralen plus UVA in mammalian cells.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.