Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

Quadruplex DNA formation in a region of the tRNA gene supF associated with hydrogen peroxide mediated mutations.

Biochemistry - 3 Sept 1991

Akman S A, Lingeman R G, Doroshow J H, Smith S S

Abstract excerpt

A hot spot for H2O2/Fe-mediated mutation has been observed between bases 154 and 170 of the supF gene in the mutation reporter plasmid pZ189 [Moraes et al. (1990) Carcinogenesis 11, 283; Akman et al. (1991) Mutat. Res. (in press)]. To further characterize this hot spot, we synthesized the 33mer d(pAAAGTGATGGTGGTGGGGGAAGGATTCGAACCT) (pZ33), which is complementary to bases 159-191 of the supF gene. pZ33 annealed...

Topics

Base Composition
Base Sequence
DNA, Bacterial
Electrophoresis, Polyacrylamide Gel
Escherichia coli
Genes, Bacterial
Hydrogen Peroxide
Iron
Molecular Sequence Data
Mutation
Nucleic Acid Conformation

Methodology Data sources Editorial policy Privacy About Contact Helena Bioinformatics

Plasmids

RNA, Transfer

Source

Identifiers

PMID: 1888727
DOI: 10.1021/bi00099a022

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 29 Aug 2026. Prepared record publication-1888727-2026-08-29.1. Manifest publication-graph-cohort-2026-08-29.1.

Source receipt: PubMed via Helena Literature Corpus, retrieved 29 Aug 2026.

Community interpretation

Discuss the evidence

Ask a question, add context or challenge an interpretation. Community activity is separate from scientific evidence strength.

0

discussions

0

replies

Citations encouraged

Claims remain attributable.

No discussion yet

Be the first to add a careful, cited interpretation.

Related research

Semantic proximity does not establish scientific evidence.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

Quadruplex DNA formation in a region of the tRNA gene supF associated with hydrogen peroxide mediated mutations.PMID 1888727Read ↗

Copper-dependent site-specific mutagenesis by benzoyl peroxide in the supF gene of the mutation reporter plasmid pS189.Semantic proximity Read ↗

Mutagenesis by hydrogen peroxide treatment of mammalian cells: a molecular analysis.Semantic proximity Read ↗

Mutations induced in the supF gene of pSP189 by hydroxyl radical and singlet oxygen: relevance to peroxynitrite mutagenesis.Semantic proximity Read ↗

Mutations induced by ionizing radiation in a plasmid replicated in human cells. I. Similar, nonrandom distribution of mutations in unirradiated and X-irradiated DNA.Semantic proximity Read ↗

Effects of peroxynitrite dose and dose rate on DNA damage and mutation in the supF shuttle vector.Semantic proximity Read ↗

Mutagenic activity of ambient oxygen and mitomycin C in Fanconi's anaemia cells.Semantic proximity Read ↗

Mutations induced in a shuttle vector plasmid exposed to monofunctionally activated mitomycin C.Semantic proximity Read ↗

Mutations at G:C base pairs predominate after replication of peroxyl radical-damaged pSP189 plasmids in human cells.Semantic proximity Read ↗

ELF electromagnetic fields increase hydrogen peroxide (H2O2)-induced mutations in pTN89 plasmids.Semantic proximity Read ↗

N-methyl-N-nitrosourea-induced mutations in a shuttle plasmid replicated in human cells.Semantic proximity Read ↗

Carbon dioxide modulation of peroxynitrite-induced mutagenesis of the supF gene in pSP189.Semantic proximity Read ↗

Damage distribution and mutation spectrum: the case of 8-methoxypsoralen plus UVA in mammalian cells.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.