Article
[New allele-specific primers for detection of Leiden mutation in exon 10 of factor V gene in thrombophilias].
Bioorganicheskaia khimiia - 1 Mar 1997
Zykova E S, Patrushev L I, Kaiushin A L, Korosteleva M D, Miroshnikov A I, Bokarev I N, Leont'ev S G, Koshkin V M, Severin E S
Abstract excerpt
New allele-specific primers were developed which enable the facile and effective identification of the Leiden mutation in the human genome using PCR. One of the primers (allele-nonspecific), which is complementary to the nucleotide sequence of the intron 10 sense strand, [(5')TCTCTTGAAGGAAATGCCCCATTA], was described by B. Dahlback in 1994. Two other primers (allele-specific), (5')TAAGAGCAGATCCCTGGACAGCCA and...
Read the complete abstract on PubMedTopics
Share this publication in a Topic to start or enrich a Post.