Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

Tissue-specific transcription of the rat tyrosine hydroxylase gene requires synergy between an AP-1 motif and an overlapping E box-containing dyad.

Neuron - 1 Jul 1992

Yoon S O, Chikaraishi D M

Abstract excerpt

Transcription of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, is regulated in a tissue-specific manner. We have identified sequences from -205 to -182 as the minimal enhancer for TH in pheochromocytoma cells using site-directed mutagenesis. This segment (TGATTCAGAGGCAGGTGCCTGTGA) is composed of an AP-1 motif (TGATTCA) and an overlapping 20 bp dyad whose core resembles an E...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to Base Sequence
Share to DNA
Share to Gene Expression

Methodology Data sources Editorial policy Privacy Delete account & data About Contact Helena Bioinformatics

Share to Molecular Sequence Data

Share to Mutation

Share to Transcription, Genetic

Share to Tumor Cells, Cultured

Source

Identifiers

PMID: 1352985
DOI: 10.1016/0896-6273(92)90220-8

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 7 Sept 2026. Manifest publication-graph-cohort-2026-09-08.1.

Source receipt: pubmed, retrieved 7 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence. Graph snapshot: 2026-09-29.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

Tissue-specific transcription of the rat tyrosine hydroxylase gene requires synergy between an AP-1 motif and an overlapping E box-containing dyad.PMID 1352985Read ↗

Human tyrosine hydroxylase natural genetic variation: delineation of functional transcriptional control motifs disrupted in the proximal promoter.Semantic proximity Read ↗

The human tyrosine hydroxylase gene promoter.Semantic proximity Read ↗

Regulation of the transcriptional activity of the tyrosine hydroxylase gene by androgen receptor.Semantic proximity Read ↗

Functional consequences of genetic variation in primates on tyrosine hydroxylase (TH) expression in vitro.Semantic proximity Read ↗

Multiple protein factors interact with the cis-regulatory elements of the proximal promoter in a cell-specific manner and regulate transcription of the dopamine beta-hydroxylase gene.Semantic proximity Read ↗

DNA regulatory sequences of the rat tyrosine hydroxylase gene direct correct catecholaminergic cell-type specificity of a human growth hormone reporter in the CNS of transgenic mice causing a dwarf phenotype.Semantic proximity Read ↗

CRE and TRE sequences of the rat tyrosine hydroxylase promoter are required for TH basal expression in adult mice but not in the embryo.Semantic proximity Read ↗

Identification of cis-regulatory sequences in the human angiotensinogen gene by transgene coplacement and site-specific recombination.Semantic proximity Read ↗

Identification and functional validation of a 5' upstream regulatory sequence in the human tyrosinase gene homologous to the locus control region of the mouse tyrosinase gene.Semantic proximity Read ↗

Demonstration of a testis-specific trans-acting factor Tet-1 in vitro that binds to the promoter of the mouse protamine 1 gene.Semantic proximity Read ↗

A tetranucleotide polymorphic microsatellite, located in the first intron of the tyrosine hydroxylase gene, acts as a transcription regulatory element in vitro.Semantic proximity Read ↗

cAMP-mediated stimulation of tyrosine hydroxylase mRNA translation is mediated by polypyrimidine-rich sequences within its 3'-untranslated region and poly(C)-binding protein 2.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.