Article

Interferon Receptor Signaling Pathways Regulating PD-L1 and PD-L2 Expression

2019-12-01

Abstract excerpt

(Cell Reports 19, 1189–1201; May 9, 2017) In the originally published version of this article, the PD-L1 promoter was mistakenly described to be cloned into the BglII/SacI sites of the pGL3 basic vector instead of the BglII site. Therefore, in Table S1 the corresponding primers should be: BglII PDL1 Prom F GGGGTTAGATCTTAGAAGTTCAGCGCGGGATA BglII PDL1 Prom R GGGGTTAGATCTCAGCGAGCTAGCCAGAGATACT The authors regret this...

Topics

Open a Topic to create a Post that cites this publication.

Cancer Immunotherapy and Biomarkers

Identifiers and source

Literature Corpus work: 97e377f4-e211-53d7-aa3d-bbb350124950
DOI: 10.1016/j.celrep.2019.11.113

Open publication

Related research

Semantic proximity does not establish scientific evidence.

Click a neighbor to travelStep 1 · 12 closest

Interferon Receptor Signaling Pathways Regulating PD-L1 and PD-L2 ExpressionDOI 10.1016/j.celrep.2019.11.113Read

Transcriptional reprogramming and constitutive PD-L1 expression in melanoma are associated with dedifferentiation and activation of interferon and tumor necrosis factor signaling pathwaysSemantic proximity Read

Complex regulatory network of programmed death-ligand 1 in cancer: Cancer immunomodulation from molecular mechanisms to clinical applicationsSemantic proximity Read

PDL1 Signals through Conserved Sequence Motifs to Overcome Interferon-Mediated CytotoxicitySemantic proximity Read

PD-L1 up-regulation in melanoma increases disease aggressiveness and is mediated through miR-17-5pSemantic proximity Read

Transcriptional Reprogramming and Constitutive PD-L1 Expression in Melanoma Are Associated with Dedifferentiation and Activation of Interferon and Tumour Necrosis Factor Signalling PathwaysSemantic proximity Read

Differentiation status determines the effects of IFNγ on the expression of PD-L1 and immunomodulatory genes in melanomaSemantic proximity Read

PD-L1: expression regulationSemantic proximity Read

IFN-gamma-induced PD-L1 expression in melanoma depends on p53 expressionSemantic proximity Read

The 3’ non-coding sequence negatively regulates PD-L1 expression and its regulators are systematically identified in pan-cancerSemantic proximity Read

Interferon regulatory factors: A key to tumour immunitySemantic proximity Read

RIG-I is an intracellular checkpoint that limits CD8+ T-cell antitumor immunitySemantic proximity Read

NRIR promotes immune escape in hepatocellular cancer by regulating IFNγ-induced PD-L1 expressionSemantic proximity Read