Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

Beta-thalassemia and beta[A] globin gene haplotypes in Mexican mestizos.

Human genetics - 1 Apr 1997

Villalobos-Arámbula A R, Bustos R, Casas-Castañeda M, Gutiérrez E, Perea F J, Thein S L, Ibarra B

Abstract excerpt

B-globin haplotypes of 20 beta-thalassemia (beta-thal) and 87 beta(A) Mexican mestizo chromosomes were analyzed to ascertain the origin of the beta-thal alleles and the frequencies and distribution of the beta(A) haplotypes among northwestern Mexican mestizos. Sixteen beta-thal chromosomes carried six Mediterranean alleles [five codon 39 C-->T; two IVS1:1 G-->A; two IVS1:5 G-->A; three IVS1:110 G(A; one codon 11...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to Alleles
Share to beta-Thalassemia
Share to Gene Frequency

Methodology Data sources Editorial policy Privacy Delete account & data About Contact Helena Bioinformatics

Share to Globins

Share to Haplotypes

Share to Indians, North American

Share to Mutation

Share to White People

Source

Identifiers

PMID: 9099840
DOI: 10.1007/s004390050395

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 7 Sept 2026. Manifest publication-graph-cohort-2026-09-08.1.

Source receipt: pubmed, retrieved 7 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence. Graph snapshot: 2026-09-29.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

Beta-thalassemia and beta[A] globin gene haplotypes in Mexican mestizos.PMID 9099840Read ↗

Diversity of the 5' beta-globin haplotype of four beta-thalassemia mutations in the Mexican population.Semantic proximity Read ↗

[Thalassemic alleles in Mexican mestizos].Semantic proximity Read ↗

Hb S [β6(A3)Glu→Val, GAG>GTG] in Mexican Mestizos: frequency and analysis of the 5' β-globin haplotype.Semantic proximity Read ↗

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).Semantic proximity Read ↗

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.Semantic proximity Read ↗

β-Thalassemia Haplotypes in Romania in the Context of Genetic Mixing in the Mediterranean Area.Semantic proximity Read ↗

Analysis of betaS and betaA genes in a Mexican population with African roots.Semantic proximity Read ↗

Haplotype analysis of beta thalassemia patients in Western Iran.Semantic proximity Read ↗

Haplotype analysis of the Mexican frameshift Cd 11 (-T) and -28 A->C beta-thalassemia alleles.Semantic proximity Read ↗

Identification of beta thalassemia mutations in South Brazilians.Semantic proximity Read ↗

Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.Semantic proximity Read ↗

Three Mexican Families with β thalassemia intermedia with different molecular basisSemantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.