Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

Diversity of the 5' beta-globin haplotype of four beta-thalassemia mutations in the Mexican population.

Hemoglobin - 1 Jan 2009

Morales Karina R, Magaña Maria T, Ibarra Bertha, Perea Francisco J

Abstract excerpt

beta-Globin haplotypes have been used to investigate the origin and spread of beta-globin mutations such as Hb S [beta 6(A3)Glu-->Val, GAG>GTG], Hb E [beta 26(B8)Glu-->Lys, GAG>AAG], and beta-thalassemia (beta-thal). Molecular analyses revealed the presence of 17 beta-thal mutations in the Mexican population; the most frequent of these are the nonsense codon 39 (C>T), IVS-I-1 (G>A), IVS-I-110 (G>A), and -28...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to Genetics, Population
Share to beta-Globins
Share to beta-Thalassemia

Methodology Data sources Editorial policy Privacy Delete account & data About Contact Helena Bioinformatics

Share to DNA Mutational Analysis

Share to Genetic Variation

Share to Haplotypes

Share to Mexico

Share to Mutation

Source

Identifiers

PMID: 19205976
DOI: 10.1080/03630260802625923

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 7 Sept 2026. Manifest publication-graph-cohort-2026-09-08.1.

Source receipt: pubmed, retrieved 7 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence. Graph snapshot: 2026-09-29.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

Diversity of the 5' beta-globin haplotype of four beta-thalassemia mutations in the Mexican population.PMID 19205976Read ↗

Beta-thalassemia and beta[A] globin gene haplotypes in Mexican mestizos.Semantic proximity Read ↗

Haplotypes linked to three rare beta-thalassemia mutations, originally reported in Tunisia.Semantic proximity Read ↗

Genetic heterogeneity of beta-thalassemia in southeast Sicily.Semantic proximity Read ↗

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.Semantic proximity Read ↗

β-Thalassemia Haplotypes in Romania in the Context of Genetic Mixing in the Mediterranean Area.Semantic proximity Read ↗

Hb S [β6(A3)Glu→Val, GAG>GTG] in Mexican Mestizos: frequency and analysis of the 5' β-globin haplotype.Semantic proximity Read ↗

Three Mexican Families with β thalassemia intermedia with different molecular basisSemantic proximity Read ↗

Contribution to the description of the beta-thalassemia spectrum in Tunisia and the origin of mutation diversity.Semantic proximity Read ↗

beta-Thalassemia and hemoglobin types in Argentina: determination of most frequent mutations.Semantic proximity Read ↗

RFLP haplotypes of beta-globin gene complex of beta-thalassemic chromosomes in Koreans.Semantic proximity Read ↗

Beta-thalassemia intermedia from southern Iran: IVS-II-1 (G-->A) is the prevalent thalassemia intermedia allele.Semantic proximity Read ↗

History and origin of beta-thalassemia in Turkey: sequence haplotype diversity of beta-globin genes.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.