Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

β-Hemoglobinopathies in the Lao People's Democratic Republic: Molecular diagnostics and implication for a prevention and control program.

International journal of laboratory hematology - 1 Jun 2021

Singha Kritsada, Chaibunruang Attawut, Souvanlasy Bounpalisone, Srivorakun Hataichanok, Yamsri Supawadee, Fucharoen Goonnapa, Fucharoen Supan

Abstract excerpt

INTRODUCTION: A high frequency of β-thalassemia in Lao People's Democratic Republic necessitates the importance of complete molecular data before a prevention and control program could be established. Limited data are available for Lao PDR. We have now reported an extended information on the molecular basis of β-hemoglobinopathies in this population. METHODS: The study was done on 519 unrelated Laos subjects...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to alpha-Globins
Share to beta-Globins

Methodology Data sources Editorial policy Privacy About Contact Helena Bioinformatics

Share to beta-Thalassemia

Share to DNA Mutational Analysis

Share to Hemoglobin E

Share to Hemoglobins

Share to Mutation

Source

Identifiers

PMID: 33244864
DOI: 10.1111/ijlh.13406

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 5 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

β-Hemoglobinopathies in the Lao People's Democratic Republic: Molecular diagnostics and implication for a prevention and control program.PMID 33244864Read ↗

Molecular and hematological characterization of thalassemia and hemoglobinopathies among pediatric patients in northern Lao People's Democratic Republic.Semantic proximity Read ↗

Thalassemia and hemoglobinopathies in pregnant Lao women: carrier screening, prevalence and molecular basis.Semantic proximity Read ↗

Molecular Heterogeneity of Thalassemia among Pregnant Laotian Women.Semantic proximity Read ↗

δ-Hemoglobinopathies in Thailand: screening, molecular basis, genotype-phenotype interaction, and implication for prevention and control of thalassemia.Semantic proximity Read ↗

Thalassemias and other hemoglobinopathies in the Republic of Macedonia.Semantic proximity Read ↗

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.Semantic proximity Read ↗

Molecular Characterization and Hematological Aspects of Hb E-Myanmar [β26(B8)Glu→Lys and β65(E9)Lys→Asn, HBB: c.[79G>A;198G>C]): A Novel β-Thalassemic Hemoglobin Variant.Semantic proximity Read ↗

Hemoglobin D-Punjab: origin, distribution and laboratory diagnosisSemantic proximity Read ↗

Clinical, Biochemical, and Hematological Presentation of a ß (+) Thalassemia due to the Poly A (T- > C) Mutation (HBB c.*110T > C (rs33978907)) Discovered in a Senegalese Family.Semantic proximity Read ↗

Beta-thalassemia in Yugoslavia.Semantic proximity Read ↗

The Southeast Asian 12.5 KB (delta-beta) degrees-deletion: a common beta-thalassemia in Mon-Khmer groups (Lao Theung) of South Laos.Semantic proximity Read ↗

The spectrum of β-thalassemia mutations in Gaza Strip, Palestine.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.