Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter

15 Dec 1999

Abstract excerpt

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to Kruppel-like factors research
Share to Reproductive Biology and Fertility
Share to Reproductive System and Pregnancy

Methodology Data sources Editorial policy Privacy Delete account & data About Contact Helena Bioinformatics

Source

Identifiers

PMID: 10572182
DOI: 10.1093/nar/27.24.4807

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 7 Sept 2026. Manifest publication-graph-cohort-2026-09-08.1.

Source receipt: pubmed, retrieved 7 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence. Graph snapshot: 2026-09-29.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoterPMID 10572182Read ↗

Identification of the DNA sequence that interacts with the gut-enriched Krüppel-like factor.Semantic proximity Read ↗

Isolation, Genomic Structure, and Expression of Human Erythroid Krüppel-Like Factor (EKLF)Semantic proximity Read ↗

Enterocyte differentiation marker intestinal alkaline phosphatase is a target gene of the gut-enriched Krüppel-like factorSemantic proximity Read ↗

Transactivation and growth suppression by the gut-enriched Krüppel-like factor (Krüppel-like factor 4) are dependent on acidic amino acid residues and protein-protein interaction.Semantic proximity Read ↗

Lactoferrin gene expression and regulation: an overviewSemantic proximity Read ↗

Lactoferrin-iCre: A New Mouse Line to Study Uterine Epithelial Gene FunctionSemantic proximity Read ↗

Krüpple-like factor 5 is essential for mammary gland development and tumorigenesis.Semantic proximity Read ↗

Murine Insulin Growth Factor-like (IGFL) and Human IGFL1 Proteins Are Induced in Inflammatory Skin Conditions and Bind to a Novel Tumor Necrosis Factor Receptor Family Member, IGFLR1Semantic proximity Read ↗

Can mutations in the gene encoding transcription factor EKLF (Erythroid Krüppel-Like Factor) protect us against infectious and parasitic diseases?Semantic proximity Read ↗

FKLF, a Novel Krüppel-Like Factor That Activates Human Embryonic and Fetal β-Like Globin GenesSemantic proximity Read ↗

Role of Erythroid Kruppel-like Factor in Human γ- to β-Globin Gene SwitchingSemantic proximity Read ↗

The GATA-E box-GATA motif in the EKLF promoter is required for in vivo expression.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.