Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil.

Hemoglobin - 1 Jan 2017

Carrocini Gisele C S, Venancio Larissa P R, Pessoa Viviani L R, Lobo Clarisse L C, Bonini-Domingos Claudia R

Abstract excerpt

β-Thalassemia (β-thal) is a hemolytic anemia that is caused by point mutations in most cases. The Brazilian population is highly heterogeneous and knowledge of the mutations that make up the genotypic profile of individuals can contribute information about the formation of the population and clinical condition of patients. In this study, we evaluated the mutations present in homozygous β-thal patients from Rio de...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to Introns
Share to beta-Globins
Share to beta-Thalassemia

Methodology Data sources Editorial policy Privacy Delete account & data About Contact Helena Bioinformatics

Share to Brazil

Share to Genetic Association Studies

Share to Promoter Regions, Genetic

Source

Identifiers

PMID: 28366028
DOI: 10.1080/03630269.2017.1289958

Genes

HBB

Variants

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 7 Sept 2026. Manifest publication-graph-cohort-2026-09-08.1.

Source receipt: pubmed, retrieved 7 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence. Graph snapshot: 2026-09-29.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil.PMID 28366028Read ↗

β-Globin Mutations in Egyptian Patients With β-Thalassemia.Semantic proximity Read ↗

Global distribution of β-thalassemia mutations: An update.Semantic proximity Read ↗

The spectrum of β-thalassemia mutations in Kermanshah Province in West Iran and its association with hematological parameters.Semantic proximity Read ↗

The Frequency of HBB Mutations Among β-Thalassemia Patients in Hamadan Province, Iran.Semantic proximity Read ↗

The Spectrum of HBB Mutations among 2315 Beta Thalassemia Patients of a Reference Clinic in Tehran-Iran.Semantic proximity Read ↗

β-THALASSEMIA IN TURKEY: A REVIEW OF THE CLINICAL, EPIDEMIOLOGICAL, MOLECULAR, AND EVOLUTIONARY ASPECTSSemantic proximity Read ↗

β-Thalassemia gene mutations in Antalya, Turkey: results from a single centre study.Semantic proximity Read ↗

Molecular and Hematological Analysis of Alpha- and Beta-Thalassemia in a Cohort of Mexican Patients.Semantic proximity Read ↗

The spectrum of beta-thalassemia mutations in the 22 Arab countries: a systematic review.Semantic proximity Read ↗

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.Semantic proximity Read ↗

Molecular Basis of β-Thalassemia in the Population of the Aegean Region of Turkey: Identification of A Novel Deletion Mutation.Semantic proximity Read ↗

Dominant Beta Thalassemia: A Very Rare Cause of Thalassemia in a Mediterranean Country.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.