Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

Polymerase Chain Reaction Amplification of a Repetitive DNA Sequence Specific for Mycobacterium tuberculosis

1 May 1990

Abstract excerpt

A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR). The sequences of the primers (5' to 3') were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG, and a temperature of 68 degrees C was used for annealing the primers in the reaction. Amplification produced a 123-base-pair fragment with an internal SalI...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to Bacteriophages and microbial interactions
Share to Mycobacterium research and diagnosis
Share to Tuberculosis Research and Epidemiology

Methodology Data sources Editorial policy Privacy About Contact Helena Bioinformatics

Source

Identifiers

PMID: 2109022
DOI: 10.1093/infdis/161.5.977

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 2 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

Polymerase Chain Reaction Amplification of a Repetitive DNA Sequence Specific for Mycobacterium tuberculosisPMID 2109022Read ↗

Direct detection of Mycobacterium tuberculosis in clinical specimens by DNA amplificationSemantic proximity Read ↗

Detection and identification of Mycobacterium tuberculosis by DNA amplificationSemantic proximity Read ↗

Polymerase chain reaction for detection of Mycobacterium tuberculosisSemantic proximity Read ↗

Genus-specific polymerase chain reaction for the mycobacterial dnaJ gene and species-specific oligonucleotide probesSemantic proximity Read ↗

Detection of Mycobacterium tuberculosis by PCR amplification with pan-Mycobacterium primers and hybridization to an M. tuberculosis-specific probeSemantic proximity Read ↗

A novel method for the isolation of mycobacterial DNASemantic proximity Read ↗

Sequence capture-PCR improves detection of mycobacterial DNA in clinical specimensSemantic proximity Read ↗

Amplification of a species-specific DNA fragment of Mycobacterium tuberculosis and its possible use in diagnosisSemantic proximity Read ↗

Large-scale use of polymerase chain reaction for detection of Mycobacterium tuberculosis in a routine mycobacteriology laboratorySemantic proximity Read ↗

A Search for Mycobacterial DNA in Granulomatous Tissues from Patients with Sarcoidosis Using the Polymerase Chain ReactionSemantic proximity Read ↗

Specific detection of Mycobacterium tuberculosis complex strains by polymerase chain reactionSemantic proximity Read ↗

Nucleotide Sequence Comparison of the Mycobacterial dnaJ Gene and PCR-Restriction Fragment Length Polymorphism Analysis for Identification of Mycobacterial SpeciesSemantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.