Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

The solution conformations of a mutant trp operator determined by n.m.r. spectroscopy.

The Biochemical journal - 15 Jan 1991

Lane A N

Abstract excerpt

The principal conformational features of the mutant trp operator [d(CGTACTGATTAATCAGTACG)2] have been determined by n.m.r. at different temperatures. The sugar puckers were determined from J-resolved spectroscopy and high-resolution homonuclear Hartmann-Hahn spectroscopic (HOHAHA) experiments. Extensive one-dimensional nuclear-Overhauser-enhancement (NOE) data sets were acquired at 25 degrees C using irradiation...

Topics

Base Composition
Base Sequence
Carbohydrate Conformation
Glycosides
Magnetic Resonance Spectroscopy
Molecular Sequence Data
Mutation
Nucleic Acid Conformation
Oligonucleotides
Operator Regions, Genetic
Solutions

Methodology Data sources Editorial policy Privacy About Contact Helena Bioinformatics

Temperature

Tryptophan

Source

Open in PubMed Open full text

Identifiers

PMID: 1998537
DOI: 10.1042/bj2730383
PMCID: PMC1149857

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 29 Aug 2026. Prepared record publication-1998537-2026-08-29.1. Manifest publication-graph-cohort-2026-08-29.1.

Source receipt: PubMed via Helena Literature Corpus, retrieved 29 Aug 2026.

Community interpretation

Discuss the evidence

Ask a question, add context or challenge an interpretation. Community activity is separate from scientific evidence strength.

0

discussions

0

replies

Citations encouraged

Claims remain attributable.

No discussion yet

Be the first to add a careful, cited interpretation.

Related research

Semantic proximity does not establish scientific evidence.

Research trail→

Click a neighbor to travelStep 1 · 11 closest

The solution conformations of a mutant trp operator determined by n.m.r. spectroscopy.PMID 1998537Read ↗

Three-dimensional solution NMR structure of Apo-L75F-TrpR, a temperature-sensitive mutant of the tryptophan repressor protein.Semantic proximity Read ↗

Conformational properties of the -35 region of the trp promoter in solution: comparison of the wild-type sequence with an AT transversion.Semantic proximity Read ↗

Effects of Phe-to-Trp mutation and fluorotryptophan incorporation on the solution structure of cardiac troponin C, and analysis of its suitability as a potential probe for in situ NMR studies.Semantic proximity Read ↗

19F NMR studies of the native and denatured states of green fluorescent protein.Semantic proximity Read ↗

Probing the physical basis for trp repressor-operator recognition.Semantic proximity Read ↗

Solution NMR spectroscopy of [alpha -15N]lysine-labeled rhodopsin: The single peak observed in both conventional and TROSY-type HSQC spectra is ascribed to Lys-339 in the carboxyl-terminal peptide sequence.Semantic proximity Read ↗

Conformational changes induced in the Tet repressor protein TetR(B) upon operator or anhydrotetracycline binding as revealed by time-resolved fluorescence spectroscopy on single tryptophan mutants.Semantic proximity Read ↗

13C NMR and fluorescence analysis of tryptophan dynamics in wild-type and two single-Trp variants of Escherichia coli thioredoxin.Semantic proximity Read ↗

Characterization of the tryptophan binding site of Escherichia coli tryptophan holorepressor by phosphorescence and optical detection of magnetic resonance of a tryptophan-free mutant.Semantic proximity Read ↗

Structural investigation of Tet repressor loop 154-167: a time-resolved fluorescence study of three single Trp mutants.Semantic proximity Read ↗

Detection of open and closed conformations of tryptophan synthase by 15N-heteronuclear single-quantum coherence nuclear magnetic resonance of bound 1-15N-L-tryptophan.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.