Article
Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1).
Drug metabolism and pharmacokinetics - 1 Jun 2006
Kim Su-Ryang, Saito Yoshiro, Maekawa Keiko, Sugiyama Emiko, Kaniwa Nahoko, Ueno Hideki, Okusaka Takuji, Morizane Chigusa, Yamamoto Noboru, Ikeda Masafumi, Yoshida Teruhiko, Minami Hironobu, Furuse Junji, Ishii Hiroshi, Saijo Nagahiro, Kamatani Naoyuki, Ozawa Shogo, Sawada Jun-ichi
Abstract excerpt
Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T,...
Read the complete abstract on PubMedTopics
Share this publication in a Topic to start or enrich a Post.