Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

Beta-thalassaemia in Cubans: novel allele increases the genetic diversity at the HBB locus in the Caribbean.

American journal of hematology - 1 May 2000

Muñiz A, Martinez G, Lavinha J, Pacheco P

Abstract excerpt

In order to establish the molecular basis of beta-thalassaemia in Cubans, a total of 75 unrelated individuals, with beta-thalassaemia major (7), Hb S-beta-thalassaemia (28), Hb C-beta-thalassaemia (1), and beta-thalassaemia trait (39) yielding 82 beta-thalassaemia alleles, were analyzed. Seventeen different point mutations were identified accounting for 93% of the beta-thalassaemia alleles studied, revealing a...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to Alleles
Share to beta-Thalassemia
Share to Cuba

Methodology Data sources Editorial policy Privacy Delete account & data About Contact Helena Bioinformatics

Share to Genetic Variation

Share to Globins

Share to Mutation

Share to Pregnancy

Share to Prenatal Diagnosis

Source

Identifiers

PMID: 10815781
DOI: 10.1002/(sici)1096-8652(200005)64:1<7::aid-ajh2>3.0.co;2-v

Genes

HBB

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 7 Sept 2026. Manifest publication-graph-cohort-2026-09-08.1.

Source receipt: pubmed, retrieved 7 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence. Graph snapshot: 2026-09-29.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

Beta-thalassaemia in Cubans: novel allele increases the genetic diversity at the HBB locus in the Caribbean.PMID 10815781Read ↗

Molecular characterization of beta-thalassemia mutations in Guadeloupe.Semantic proximity Read ↗

Contribution to the description of the beta-thalassemia spectrum in Tunisia and the origin of mutation diversity.Semantic proximity Read ↗

Molecular study of a large cohort of 109 haemophilia patients from Cuba using a gene panel with next generation sequencing-based technology.Semantic proximity Read ↗

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.Semantic proximity Read ↗

Beta-thalassaemia in indigenous Belgian families: identification of a novel mutation.Semantic proximity Read ↗

Region-specific genetic heterogeneity of HBB mutation distribution in South-Western Greece.Semantic proximity Read ↗

Balearic archipelago: three islands, three beta-thalassemia population patterns.Semantic proximity Read ↗

Novel promoter and splice junction defects add to the genetic, clinical or geographic heterogeneity of beta-thalassaemia in the Portuguese population.Semantic proximity Read ↗

First Spanish case of thalassemia major due to a compound heterozygosity for the IVS-II-848 (C --> A) and codon 39 (C --> T) mutations of the beta-globin gene.Semantic proximity Read ↗

HLA class I polymorphism in the Cuban population.Semantic proximity Read ↗

Molecular basis of beta-thalassemia in Morocco: possible origins of the molecular heterogeneity.Semantic proximity Read ↗

Analysis of a Novel Mexican Variant of the HBB Gene Associated with β-Thalassemia Using Bioinformatic Tools.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.