Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

Analysis of a Novel Mexican Variant of the HBB Gene Associated with β-Thalassemia Using Bioinformatic Tools.

Hemoglobin - 1 Mar 2021

Martínez Villegas Octavio, Mendoza-Meléndez Diana, Trueba-Gómez Rocio, Rosenfeld-Mann Fany, Baptista-González Héctor A, Estrada-Juárez Higinio

Abstract excerpt

We present a study performed on 54 unrelated subjects, with and without thalassemic features. Two primer pairs were proposed to perform Sanger sequencing of the complete HBB gene. The bioinformatic analysis was performed taking advantage of the availability of free online tools. In the sample, we found 11 variants, 10 reported, and one novel. Among the variants found, six are clinically important: three encode a...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to Alleles
Share to beta-Globins

Methodology Data sources Editorial policy Privacy About Contact Helena Bioinformatics

Share to beta-Thalassemia

Share to Codon, Nonsense

Share to Computational Biology

Share to Mutation

Source

Identifiers

PMID: 34060411
DOI: 10.1080/03630269.2021.1920976

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 5 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

Analysis of a Novel Mexican Variant of the HBB Gene Associated with β-Thalassemia Using Bioinformatic Tools.PMID 34060411Read ↗

Beta thalassemia in 31,734 cases with HBB gene mutations: Pathogenic and structural analysis of the common mutations; Iran as the crossroads of the Middle East.Semantic proximity Read ↗

Hb Narges Lab, a Novel Hemoglobin Variant of the β-Globin Gene.Semantic proximity Read ↗

Three Mexican Families with β thalassemia intermedia with different molecular basisSemantic proximity Read ↗

Hb Wilde and Hb Patagonia: two novel elongated beta-globin variants causing dominant beta-thalassemia.Semantic proximity Read ↗

Characterization of Two Deep Intronic Variants on the β-Globin Gene with Inconsistent Interpretations of Clinical Significance.Semantic proximity Read ↗

Investigation of mutations in the HBB gene using the 1,000 genomes database.Semantic proximity Read ↗

Two Novel and Five Rare Mutations in the Non Coding Regions of the β-Globin Gene in the Iranian Population.Semantic proximity Read ↗

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.Semantic proximity Read ↗

First Case of Hb City of Hope (HBB: c.208G > A) in Andalusia. A Molecular Update of β-Thalassemia in Southwestern Spain (Huelva Province).Semantic proximity Read ↗

Does size matter? Two new deletions in the HBB gene cause β0-thalassemia.Semantic proximity Read ↗

Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil.Semantic proximity Read ↗

Molecular characterization of hemophilia B patients in Colombia.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.