Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

Functional analysis of the recA promoter of Rhodobacter capsulatus.

Molecular & general genetics : MGG - 1 Aug 1997

Fernàndez de Henestrosa A R, Labazi M, Mar López M, Barbé J

Abstract excerpt

Expression of the Rhodobacter capsulatus recA gene is inducible by DNA damage. By using primer extension and serial deletion, we have identified the promoter of the R. capsulatus recA gene. Electrophoretic mobility-shift assays experiments have shown that a protein binds to a region of the R. capsulatus recA promoter containing the imperfect palindromic TTGTACTCATACCATGAGAACAA, which is centered on position-8...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to Molecular Sequence Data
Share to Base Sequence
Share to Binding Sites

Methodology Data sources Editorial policy Privacy Delete account & data About Contact Helena Bioinformatics

Share to DNA, Bacterial

Share to DNA Primers

Share to Genes, Bacterial

Share to Mutation

Share to Polymerase Chain Reaction

Source

Identifiers

PMID: 9294033
DOI: 10.1007/s004380050521

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 7 Sept 2026. Manifest publication-graph-cohort-2026-09-08.1.

Source receipt: pubmed, retrieved 7 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence. Graph snapshot: 2026-09-29.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

Functional analysis of the recA promoter of Rhodobacter capsulatus.PMID 9294033Read ↗

Non-reciprocal regulation of Rhodobacter capsulatus and Rhodobacter sphaeroides recA genes expression.Semantic proximity Read ↗

Molecular characterization of regulatory elements controlling expression of the Bacillus subtilis recA+ gene.Semantic proximity Read ↗

Cloning, sequencing, and transcriptional analysis of the recA gene of Pseudomonas cepacia.Semantic proximity Read ↗

Mutational analysis of the Rhizobium etli recA operator.Semantic proximity Read ↗

Cloning of theHelicobacter pylori recA gene and functional characterization of its productSemantic proximity Read ↗

Molecular design and functional organization of the RecA protein.Semantic proximity Read ↗

Purification and biochemical characterization of Escherichia coli RecA proteins mutated in the putative DNA binding site.Semantic proximity Read ↗

Biochemical and biological function of Escherichia coli RecA protein: behavior of mutant RecA proteins.Semantic proximity Read ↗

Biochemical basis of hyper-recombinogenic activity of Pseudomonas aeruginosa RecA protein in Escherichia coli cells.Semantic proximity Read ↗

Mutations at Pro67 in the RecA protein P-loop motif differentially modify coprotease function and separate coprotease from recombination activities.Semantic proximity Read ↗

Control of the endonuclease activity of type I restriction-modification systems is required to maintain chromosome integrity following homologous recombination.Semantic proximity Read ↗

Characterization of RecA1332 in vivo and in vitro. A role for alpha-helix E as a liaison between the subunit-subunit interface and the DNA and ATP binding domains of RecA protein.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.