Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

beta-Thalassemia and hemoglobin types in Argentina: determination of most frequent mutations.

American journal of hematology - 1 Feb 1997

Soria N W, Tulián C L, Plassa F, Roth G A

Abstract excerpt

In order to know the spectrum of beta-thalassemia alleles and other mutations affecting the beta-globin gene, we analyzed the hemoglobin abnormalities in 24 patients from the Province of Cordoba in Argentina. Molecular screening of samples was performed by the polymerase chain reaction (PCR), using six sets of oligonucleotides to amplify fragments encompassing the whole beta-globin coding region and splice...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to Alleles
Share to Argentina
Share to beta-Thalassemia

Methodology Data sources Editorial policy Privacy Delete account & data About Contact Helena Bioinformatics

Share to Gene Frequency

Share to Globins

Share to Hemoglobins

Share to Mutation

Source

Identifiers

PMID: 9034292
DOI: 10.1002/(sici)1096-8652(199702)54:2<160::aid-ajh11>3.0.co;2-j

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 7 Sept 2026. Manifest publication-graph-cohort-2026-09-08.1.

Source receipt: pubmed, retrieved 7 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence. Graph snapshot: 2026-09-29.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

beta-Thalassemia and hemoglobin types in Argentina: determination of most frequent mutations.PMID 9034292Read ↗

[Most frequent beta-thalassemia mutations in the Argentinian population].Semantic proximity Read ↗

Molecular characterization of beta-thalassemia genes in an Argentine population.Semantic proximity Read ↗

[Molecular genetics of the thalassemias in Argentina].Semantic proximity Read ↗

The thalassemia syndromes: molecular characterization in the Spanish population.Semantic proximity Read ↗

Molecular heterogeneity of beta-thalassemia alleles in Spain and its importance in the diagnosis and prevention of beta-thalassemia major and sickle cell disorders.Semantic proximity Read ↗

Molecular spectrum of beta-thalassemia mutations in Northwestern Iran.Semantic proximity Read ↗

Sickle cell anemia, sickle cell beta-thalassemia, and thalassemia major in Albania: characterization of mutations.Semantic proximity Read ↗

Molecular characterization of beta-thalassemia mutations in Guadeloupe.Semantic proximity Read ↗

Three Mexican Families with β thalassemia intermedia with different molecular basisSemantic proximity Read ↗

First Case of Hb City of Hope (HBB: c.208G > A) in Andalusia. A Molecular Update of β-Thalassemia in Southwestern Spain (Huelva Province).Semantic proximity Read ↗

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.Semantic proximity Read ↗

Molecular characterization of beta-thalassemia in Syria.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.