Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

De Novo Occurrence of Hb Chile [β28(B10) Leu→Met] in a Korean Boy with Methemoglobinemia.

Hemoglobin - 1 Sept 2024

Jung Hyeon Jun, Kim Boram, Kim Hee-Jin, Lee Mee Jeong

Abstract excerpt

Hemoglobin (Hb) Chile, a variant of Hb M, is produced by a point mutation of CTG→ATG on codon 29 (legacy codon 28) of the Hb β locus gene, which results in an amino acid substitution of Leu→Met. It has been identified in two families worldwide and is inherited in an autosomal dominant manner. Here, we report a case of Hb Chile in which a de novo mutation was detected in the proband. A 17-year-old male presented...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to Adolescent
Share to Amino Acid Substitution
Share to Hemoglobins, Abnormal

Methodology Data sources Editorial policy Privacy Delete account & data About Contact Helena Bioinformatics

Share to Mutation

Share to Point Mutation

Share to Republic of Korea

Source

Identifiers

PMID: 39311655
DOI: 10.1080/03630269.2024.2403405

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 7 Sept 2026. Manifest publication-graph-cohort-2026-09-08.1.

Source receipt: pubmed, retrieved 7 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence. Graph snapshot: 2026-09-29.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

De Novo Occurrence of Hb Chile [β28(B10) Leu→Met] in a Korean Boy with Methemoglobinemia.PMID 39311655Read ↗

The First Chinese with Hb Chile Leading to chronic Anemia and methemoglobinemia: A Case ReportSemantic proximity Read ↗

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.Semantic proximity Read ↗

The Importance of Characterizing the Hemoglobin Instability of New Variants: The Case of Hb Dompierre [β29(B11)Gly→Arg, HBB: c.88G>C].Semantic proximity Read ↗

Hb Castilla [beta32(B14)Leu --> Arg] caused by a de novo mutation.Semantic proximity Read ↗

A novel stoploss mutation CYB5R3 c.906A>G(p.*302Trpext*42) involved in the pathogenesis of hereditary methemoglobinemia.Semantic proximity Read ↗

Molecular Characterization and Hematological Aspects of Hb E-Myanmar [β26(B8)Glu→Lys and β65(E9)Lys→Asn, HBB: c.[79G>A;198G>C]): A Novel β-Thalassemic Hemoglobin Variant.Semantic proximity Read ↗

Hb-M "Hyde Park": a de novo mutation, identified by mass spectrometry and DNA analysis.Semantic proximity Read ↗

Hb M Dothan [beta 25/26 (B7/B8)/(GGT/GAG-->GAG//Gly/Glu-->Glu]; a new mechanism of unstable methemoglobin variant and molecular characteristics.Semantic proximity Read ↗

Hb Nebraska [β86(F2)Ala→Ile (HBB:c.259G>A;260C>T)]: a unique high oxygen affinity hemoglobin variant with a double nucleotide substitution within the same codon.Semantic proximity Read ↗

Novel, de novo, beta-globin variant with decreased oxygen affinity (HBB:c.317T>A, "Hemoglobin St. George") in a healthy child with low oxygen saturations and anemia.Semantic proximity Read ↗

A Rare Case of Abnormal Hemoglobin Variant Hb Mizuho: [HBB: c.206T > C β 68(E12) Leu-Pro]: A First Report in the Chinese Population.Semantic proximity Read ↗

Description of Three New α Variants and Four New β Variants: Hb Montluel [α110(G17)Ala → Val; HBA1: c.332C > T], Hb Cap d'Agde [α131(H14)Ser → Cys; HBA2: c.395C > G] and Hb Corsica [α100(G7)Leu → Pro; HBA1: 302T > C]; Hb Nîmes [β104(G6)Arg → Gly; HBB: c.313A > G], Hb Saint Marcellin [β112(G14)Cys → Gly; HBB: c.337T > G], Hb Saint Chamond [β80(EF4)Asn → 0; HBB: c.241_243delAAC] and Hb Dompierre [β29(B11)Gly → Arg; HBB: c.88G > C].Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.