Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

Hb Wilde and Hb Patagonia: two novel elongated beta-globin variants causing dominant beta-thalassemia.

European journal of haematology - 1 Jun 2015

Scheps Karen G, Hasenahuer Marcia A, Parisi Gustavo, Fornasari María S, Pennesi Sandra P, Erramouspe Beatriz, Basack Felisa N, Veber Ernesto S, Aversa Luis, Elena Graciela, Varela Viviana

Abstract excerpt

We describe here the molecular and hematological characteristics of novel frameshift mutations in exon 2 of the HBB gene (in heterozygous state) found in two Argentinean pediatric patients with dominant β-thalassemia-like features. In Hb Wilde, HBB:c.270_273delTGAG(p.Glu90Cysfs*67), we detected t...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to beta-Globins
Share to beta-Thalassemia
Share to Blood Cell Count

Methodology Data sources Editorial policy Privacy About Contact Helena Bioinformatics

Share to Erythrocyte Indices

Share to Frameshift Mutation

Share to Hemoglobins, Abnormal

Share to Protein Multimerization

Source

Identifiers

PMID: 25284604
DOI: 10.1111/ejh.12456

Genes

HBB

Variants

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 4 Sept 2026. Prepared record publication-25284604-2026-09-04.2. Manifest publication-graph-cohort-2026-09-04.2.

Source receipt: PubMed via Helena Literature Corpus, retrieved 4 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

Hb Wilde and Hb Patagonia: two novel elongated beta-globin variants causing dominant beta-thalassemia.PMID 25284604Read ↗

Hb Narges Lab, a Novel Hemoglobin Variant of the β-Globin Gene.Semantic proximity Read ↗

Analysis of a Novel Mexican Variant of the HBB Gene Associated with β-Thalassemia Using Bioinformatic Tools.Semantic proximity Read ↗

Hb Ryazan: An Elongated C-Terminal β-Chain Due to a New Frameshift Mutation, HBB: c.396delG p.Val133Trpfs*25.Semantic proximity Read ↗

Two Novel and Five Rare Mutations in the Non Coding Regions of the β-Globin Gene in the Iranian Population.Semantic proximity Read ↗

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.Semantic proximity Read ↗

The Importance of Characterizing the Hemoglobin Instability of New Variants: The Case of Hb Dompierre [β29(B11)Gly→Arg, HBB: c.88G>C].Semantic proximity Read ↗

Three Mexican Families with β thalassemia intermedia with different molecular basisSemantic proximity Read ↗

Complex interaction of δ-globin variant HbA2-Famagusta combined with β-globin variant Hb Monroe in cis with the HBB:c.-92C>G mutation: hematological characteristics and molecular diagnostic insights.Semantic proximity Read ↗

A Novel Frameshift Mutation of HBB Causing Dominant β-Thalassemia in a Chinese Individual.Semantic proximity Read ↗

Hb Antalya [codons 3-5 (Leu-Thr-Pro-->Ser-Asp-Ser)]: a new unstable variant leading to chronic microcytic anemia and high Hb A2.Semantic proximity Read ↗

Molecular and phenotype characterization of an elongated β-globin variant produced by HBB:C.313delA.Semantic proximity Read ↗

Effect of Mutations on mRNA and Globin Stability: The Cases of Hb Bernalda/Groene Hart and Hb Southern Italy.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.