Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

A novel β(0)-thalassemia frameshift mutation: [HBB:c.216delT].

Hemoglobin - 1 Jan 2012

Konialis Christopher, Hagnefelt Birgitta, Sevastidou Sophia, Pispili Katerina, Pangalos Constantinos

Abstract excerpt

A 33-year-old adult male of Greek ethnicity, with hematological indices suggesting β(0)-thalassemia (β(0)-thal) trait, was investigated for HBB gene mutations in the course of preparation for preimplantation genetic diagnosis (PGD). Application of a routine diagnostic protocol, consisting of sequence analysis of the HBB gene, coupled to multiplex ligation-dependent probe amplification (MLPA), identified a single...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to Base Sequence
Share to beta-Globins
Share to beta-Thalassemia

Methodology Data sources Editorial policy Privacy About Contact Helena Bioinformatics

Share to Frameshift Mutation

Share to Greece

Share to Pedigree

Source

Identifiers

PMID: 23106651
DOI: 10.3109/03630269.2012.736442

Genes

HBB
PGD

Variants

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 7 Sept 2026. Manifest publication-graph-cohort-2026-09-08.1.

Source receipt: pubmed, retrieved 7 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

A novel β(0)-thalassemia frameshift mutation: [HBB:c.216delT].PMID 23106651Read ↗

β-Thalassemia major resulting from compound heterozygosity for HBB: c.92+2T>C [formerly known as IVS-I-2 (T>C)] and a novel β(0)-thalassemia frameshift mutation: HBB: c.209delG; p.Gly70Valfs*20.Semantic proximity Read ↗

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.Semantic proximity Read ↗

Coinheritance of a novel mutation on the HBA1 gene: c.187delG (p.W62fsX66) [codon 62 (-G) (α1)] with the α212 patchwork allele and Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T].Semantic proximity Read ↗

A frameshift at codons 77/78 (-C): a novel beta-thalassemia mutation.Semantic proximity Read ↗

α(+)-Thalassemia Due to a Frameshift Mutation of the α2-Globin Gene [codons 55/56 (+T) or HBA2: c.168dup].Semantic proximity Read ↗

Description of a rare β-globin gene mutation, IVS-II-848 (C>A) (HBB: c.316-3C>A) in association with IVS-I-1 (G>A) (HBB: c.92 + 1G>A), observed in a Syrian family: a case report.Semantic proximity Read ↗

Hb Filottrano [codon 120 (-A)]: a novel frameshift mutation in exon 3 of the β-globin gene causing dominantly inherited β-thalassemia intermedia.Semantic proximity Read ↗

A Novel -72 (T→A) β-Promoter Mutation Causing Slightly Elevated HbA2 in a Vietnamese Heterozygote.Semantic proximity Read ↗

Co-heredity of silent CAP + 1570 T>C (HBB:c*96T>C) defect and severe β-thal mutation: a cause of mild β-thalassemia intermedia.Semantic proximity Read ↗

[Current clinical approaches and gene mutation study of beta-thalassemia major].Semantic proximity Read ↗

HBB: c.316-125A>G and HBB: c.316-42delC: Phenotypic Evaluations of Two Rare Changes in the Second Intron of the HBB Gene.Semantic proximity Read ↗

A Novel Mutation in the Promoter Region of the β-Globin Gene: HBB: c.-127G > C.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.