Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

A frameshift at codons 77/78 (-C): a novel beta-thalassemia mutation.

Hemoglobin - 1 Aug 2004

Perea Francisco J, Magaña M Teresa, Esparza M Amparo, Ibarra Bertha

Abstract excerpt

We identified and characterized a novel beta-thalassemia (beta-thal) mutation due to a deletion of cytosine at codons 77/78 (-C) [CAC(His) CA- or CTG(Leu)--> -TG] found in a heterozygous state in four members of a Mexican family. The beta haplotype analysis performed on the family revealed that the frameshift at codons 77/78 (-C) mutation in this family is associated with haplotype V [- + - - - + ] and framework...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to Alleles
Share to beta-Thalassemia
Share to Codon

Methodology Data sources Editorial policy Privacy About Contact Helena Bioinformatics

Share to Family

Share to Frameshift Mutation

Share to Haplotypes

Share to Mexico

Source

Identifiers

PMID: 15481896
DOI: 10.1081/hem-120040220

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 7 Sept 2026. Manifest publication-graph-cohort-2026-09-07.1.

Source receipt: pubmed, retrieved 7 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

A frameshift at codons 77/78 (-C): a novel beta-thalassemia mutation.PMID 15481896Read ↗

Detection of two rare beta-thalassemia alleles found in the Tunisian population: codon 47 (+A) and codons 106/107 (+G).Semantic proximity Read ↗

A novel frameshift mutation: deletion of C in codons 74/75 of the beta-globin gene causes beta zero-thalassemia in a Turkish patient.Semantic proximity Read ↗

Identification of a novel beta0-thalassemia mutation, codons 80/81 (-C), in an Iranian family.Semantic proximity Read ↗

α(+)-Thalassemia Due to a Frameshift Mutation of the α2-Globin Gene [codons 55/56 (+T) or HBA2: c.168dup].Semantic proximity Read ↗

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.Semantic proximity Read ↗

A novel α-thalassemia frameshift mutation: codon 8 (-C).Semantic proximity Read ↗

Beta-thalassemia intermedia in a Lebanese child due to homozygosity for the -88 (C-->T) mutation.Semantic proximity Read ↗

Severe beta-thalassemia in frameshift codon 6 (-A) homozygotes: effects of haplotype on phenotype.Semantic proximity Read ↗

Coinheritance of a Rare Nucleotide Substitution on the β-Globin Gene and Other Known Mutations in the Globin Clusters: Management in Genetic Counseling.Semantic proximity Read ↗

Compound heterozygote condition in beta thalassemia major due to a novel single nucleotide deletion (-T) at codon 69 in association with IVS 1-5 (G>C) mutation.Semantic proximity Read ↗

Identification of a compound beta-thalassemia homozygosity [codon 10 (GCC-->GCA) and codon 16 (-C)] in an Afghan family.Semantic proximity Read ↗

A new insertion mutation in the beta-globin gene [codons 45/46 (+A)] resulting in a beta-thalassemia minor phenotype.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.