Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

Identification of two novel β-globin gene mutations HBB: exon3del, HBB: c.-81A>C.

Hematology (Amsterdam, Netherlands) - 1 Dec 2023

Cao YaXuan, Luo JianMing

Abstract excerpt

BACKGROUND: β-thalassemia is a common inherited hemolytic disorder caused by mutations in the HBB gene. Genetic analysis of 2 new beta-thalassemia patients with deletion mutations in the HBB gene and their family members. METHODS: Their clinical presentation and blood phenotypic tests were analyzed. We detected the approximate degree of deletion of these two new HBB gene deletion mutants and analyzed their...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to alpha-Thalassemia
Share to beta-Globins
Share to beta-Thalassemia

Methodology Data sources Editorial policy Privacy About Contact Helena Bioinformatics

Share to Genotype

Share to Mutation

Share to Phenotype

Share to Pregnancy

Source

Identifiers

PMID: 37815396
DOI: 10.1080/16078454.2023.2265723

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 4 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

Identification of two novel β-globin gene mutations HBB: exon3del, HBB: c.-81A>C.PMID 37815396Read ↗

Identification of a novel 10.3 kb deletion causing α0-thalassemia by third-generation sequencing: Pedigree analysis and genetic diagnosis.Semantic proximity Read ↗

Characterization of a Novel 71.8 kb α0-Thalassemia Deletion and Subsequent Summary of a Practical Procedure for Thalassemia Molecular Diagnosis.Semantic proximity Read ↗

Does size matter? Two new deletions in the HBB gene cause β0-thalassemia.Semantic proximity Read ↗

Molecular and phenotype characterization of an elongated β-globin variant produced by HBB:C.313delA.Semantic proximity Read ↗

Identification of seven novel variants in the β-globin gene in transfusion-dependent and normal patientsSemantic proximity Read ↗

Identification of Two Novel β-Thalassemia Mutations (HBB: c.335-346del and HBB: c.108 C > G) in Han Chinese.Semantic proximity Read ↗

Next generation sequencing identifies a novel rearrangement in the HBB cluster permitting to-the-base characterization.Semantic proximity Read ↗

A Woman with Missing Hb A2 Due to a Novel (εγ)δβ0-Thalassemia and a Novel δ-Globin Variant Hb A2-Gebenstorf (HBD: c.209G>A).Semantic proximity Read ↗

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.Semantic proximity Read ↗

Two novel mutations in the 3' untranslated region of the beta-globin gene that are associated with the mild phenotype of beta thalassemia.Semantic proximity Read ↗

Identification of a Novel Variant c.163delG in HBB Gene Resulting in a Beta Null Phenotype in a Proband with Thalassemia Intermedia.Semantic proximity Read ↗

Hb Ryazan: An Elongated C-Terminal β-Chain Due to a New Frameshift Mutation, HBB: c.396delG p.Val133Trpfs*25.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.