Article
Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations.
Human mutation - 1 Apr 2003
Kim Chi Hwa, Hwang Hye Zin, Song Seng Mi, Paik Kyung Hoon, Kwon Eun Kyung, Moon Kwang Bin, Yoon Jeong Hyeok, Han Cheol Kyu, Jin Dong-Kyu
Abstract excerpt
Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG,...
Read the complete abstract on PubMedTopics
Share this publication in a Topic to start or enrich a Post.