Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

Frequency of the cystic fibrosis delta F 508 mutation in a population from São Paulo State, Brazil.

Brazilian journal of medical and biological research = Revista brasileira de pesquisas medicas e biologicas - 1 Oct 1993

Martins C S, Ribeiro F, Costa F F

Abstract excerpt

Cystic fibrosis (CF) nonrelated patients (N = 24) from São Paulo State, Brazil, were screened for the presence of the delta F 508 mutation by PCR amplification of the deletion region with the primers C16B (5'GTTTTCCTGGATTATGCCTGGGCAC3') and C16D (5'GTTGGCATGCTTTGATGACGCTTC 3'), and by acrylamide gel electrophoresis. The allelic frequency of the delta F 508 mutation was 33% (15/48 chromosomes). The genotype...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to Base Sequence
Share to Cystic Fibrosis

Methodology Data sources Editorial policy Privacy Delete account & data About Contact Helena Bioinformatics

Share to Gene Frequency

Share to Genetics, Population

Share to Genotype

Share to Molecular Sequence Data

Share to Mutation

Share to Polymerase Chain Reaction

Source

Identifiers

PMID: 8312835

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 7 Sept 2026. Manifest publication-graph-cohort-2026-09-08.1.

Source receipt: pubmed, retrieved 7 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence. Graph snapshot: 2026-09-29.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

Frequency of the cystic fibrosis delta F 508 mutation in a population from São Paulo State, Brazil.PMID 8312835Read ↗

Frequency of the deltaF508 mutation in 108 cystic fibrosis patients in Sao Paulo: comparison with reported Brazilian data.Semantic proximity Read ↗

CFTR molecular analysis reveals infrequent allele frequencies in nine cystic fibrosis patients from São Paulo State, Brazil.Semantic proximity Read ↗

Cystic fibrosis in a southern Brazilian population: characteristics of 90% of the alleles.Semantic proximity Read ↗

Cystic fibrosis in Argentina: the frequency of the delta F508 mutation.Semantic proximity Read ↗

Molecular analysis in Brazilian cystic fibrosis patients reveals five novel mutations.Semantic proximity Read ↗

Prevalence of ΔF508 mutation in the cystic fibrosis transmembrane conductance regulator gene among cystic fibrosis patients from a Brazilian referral center.Semantic proximity Read ↗

Geographic distribution and regional origin of 272 cystic fibrosis mutations in European populations. The Biomed CF Mutation Analysis Consortium.Semantic proximity Read ↗

Analysis of 16 cystic fibrosis mutations in Mexican patients.Semantic proximity Read ↗

[Frequency of delta F508 mutation in Venezuelan patients with cystic fibrosis].Semantic proximity Read ↗

Prevalence of deltaF508, G551D, G542X, and R553X mutations among cystic fibrosis patients in the North of Brazil.Semantic proximity Read ↗

Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry.Semantic proximity Read ↗

Low frequency of the deltaAF508 mutation of the CFTR gene in a highly admixed population in Bahia, Brazil.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.