Article
Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families.
Human genomics - 8 Dec 2023
Bao Xiuqin, Qin Danqing, Wang Jicheng, Chen Jing, Yao Cuize, Liang Jie, Liang Kailing, Wang Yixia, Wang Yousheng, Du Li, Yin Aihua
Abstract excerpt
BACKGROUND: β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two...
Read the complete abstract on PubMedTopics
Share this publication in a Topic to start or enrich a Post.