Discover Community Create You

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Article

Molecular characterisation and polymorphism of MinLm1, a minisatellite from the phytopathogenic ascomycete Leptosphaeria maculans.

Current genetics - 1 Aug 2001

Attard A, Gourgues M, Gout L, Schmit J, Roux J, Narcy J P, Balesdent M H, Rouxel T

Abstract excerpt

A sequence-characterised amplified region marker was identified in the phytopathogenic fungus Leptosphaeria maculans, which generated a single-banding pattern corresponding to six alleles showing size polymorphism between L. maculans field isolates. The size polymorphism was due to 2-7 tandem repeats of the 23-bp motif 5' TCTTACTTACATACACACCTCCC 3'. The repeated sequence, termed MinLm1, shares many features...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to Ascomycota
Share to Brassica napus

Methodology Data sources Editorial policy Privacy About Contact Helena Bioinformatics

Share to DNA, Fungal

Share to Genetics, Population

Share to Genome, Fungal

Share to Minisatellite Repeats

Share to Sequence Homology, Nucleic Acid

Share to Tandem Repeat Sequences

Source

Identifiers

PMID: 11570517
DOI: 10.1007/s002940100228

Genes

CAT

Provenance

PubMed metadata and Literature Corpus relationships. Corpus snapshot updated 7 Sept 2026. Manifest publication-graph-cohort-2026-09-07.1.

Source receipt: pubmed, retrieved 7 Sept 2026.

Related research

Semantic proximity does not establish scientific evidence.

Research trail→

Click a neighbor to travelStep 1 · 12 closest

Molecular characterisation and polymorphism of MinLm1, a minisatellite from the phytopathogenic ascomycete Leptosphaeria maculans.PMID 11570517Read ↗

Genetic variability and distribution of mating type alleles in field populations of Leptosphaeria maculans from France.Semantic proximity Read ↗

MPSeqM, a tool combining multiplex PCR and high-throughput sequencing to study the polymorphism of eight Leptosphaeria maculans avirulence genes and its application to field surveys in France.Semantic proximity Read ↗

MPSeqM, a tool combining multiplex PCR and high-throughput sequencing to study the polymorphism of eight <i>Leptosphaeria maculans</i> avirulence genes and its application to field surveys in FranceSemantic proximity Read ↗

The minisatellite MSB1, in the fungus Botrytis cinerea, probably mutates by slippage.Semantic proximity Read ↗

Genetic diversity and population structure of Leptosphaeria maculans isolates in Western Canada.Semantic proximity Read ↗

Phylogenetic relationships between members of the crucifer pathogenic Leptosphaeria maculans species complex as shown by mating type (MAT1-2), actin, and beta-tubulin sequences.Semantic proximity Read ↗

Genome-Wide Mapping of Histone Modifications in Two Species of Leptosphaeria Maculans Showing Contrasting Genomic Organization and Host SpecializationSemantic proximity Read ↗

Megasatellites: a peculiar class of giant minisatellites in genes involved in cell adhesion and pathogenicity in Candida glabrataSemantic proximity Read ↗

Molecular identification of Tuber magnatum ectomycorrhizae in the fieldSemantic proximity Read ↗

Genetic structure of a population of the fungus Leptosphaeria maculans in a disease nursery of Brassica napus in Australia.Semantic proximity Read ↗

Gene loss in the fungal canola pathogen Leptosphaeria maculans.Semantic proximity Read ↗

Analysis of microsatellite markers in the genome of the plant pathogen Ceratocystis fimbriata.Semantic proximity Read ↗

⌁Select a neighboring publication to make it the new centre.