A novel 31bp deletion within the CDKL5 gene is significantly associated with growth traits in Dezhou donkey.

doi:10.1080/10495398.2021.1977653

Loading publication...

Noodle always counts identifier-free feature events for service operation. With your permission, Google Analytics can also estimate audience and engagement. Search text, publication identifiers, cookies, IP addresses and browser fingerprints are never included in Noodle's first-party event counters.

Privacy details

Community

Back to search

Article

A novel 31bp deletion within the CDKL5 gene is significantly associated with growth traits in Dezhou donkey.

Animal biotechnology - 1 Jun 2023

Wang Fuwen, Wang Gang, Dalielihan Baligen, Wang Zhaofei, Chang Tingjin, Yang Ge, Lei Chuzhao, Dang Ruihua

Abstract excerpt

The discovery of molecular markers which associate with livestock economic traits is of great significance for livestock breeding. Selective analysis has found a potential correlation between CDKL5 and growth traits, but there is still a lack of experimental proof. In this study, a 31-bp deletion (g.176595_176626delATGTCACATGTGGTACTGCCATGTGGAATTT) of CDKL5 gene was found by sequencing. The 31-bp indel was then...

Read the complete abstract on PubMed

Topics

Share this publication in a Topic to start or enrich a Post.

Share to Biomarkers
Share to Equidae
Share to Genotype
Share to Phenotype

Methodology Data sources Editorial policy Privacy About Contact Helena Bioinformatics

Share to Polymorphism, Genetic

Source

Open in PubMed

Identifiers

PMID: 34543156
DOI: 10.1080/10495398.2021.1977653

Provenance

PubMed metadata and Literature Corpus relationships.